Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W024A08
Clone ID W024A08
Vector pT1betageo
Project ggtc

Sequence tag W024A08
Sequence
AGGTGCCGCGGCGGCGGCGGCGGTGGCGGCGGTGGGTACGCGTTGGTGCGGCCTGTTTTGGGCCATGTCCGTGTGAGGAC
GCCGCAGCCGACAACCTCTCCTCTCCGGCTGGCCGGTAGAAACGCGCACCATGGGCTCCATCCTGAGTCGCCGCATCGCG
GGCGTAGAGGACATCGACATACAGGCCAACTCGGCCTATCGCTACCCTCCGAAGTCCG
Sequence Type mRNA
Unitrap ID UNI477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4886256..4886473 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022517 (Mgrn1) NP_083933 mahogunin, ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2447670]

 
Come back to gene ENSMUSG00000022517


For any suggestions or comments, please send an email to unitrap@crg.es