Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W024B06
Clone ID W024B06
Vector pT1betageo
Project ggtc

Sequence tag W024B06
Sequence
AAAAACTGTGTGATCGGCTTGAACTAGCAAGCTTGCAGGGCTTGAATGAAATCATGGCTTCATCTACGAGAGAAGTAGGA
AAAGCTGCACTTGAAAGACAGATAGAAGAAGTGAATGAGCAGATGAGGAGAGAGAAGGAGGAAGCTGATGCTCGGATGCG
GCAAGCATCCAAGAATGCAGAGAAGTCAACTGGTGGAAGTGGGAGTGGCAGTAAAAATTGGTCAGAAGATGATCTGCAAT
TATTAATTAAAGCTGTCAATCTCTTCCCTGCTGGAACAAATTCAAGATGGGAAGTCATTGCTAATTATATGAACATACAT
TCTTCTTATGGCGTCAAAAGAACTGCCAAAGATGTTATTAGCAAGGCTAAAAGCCTCCAAAAACTTGACCCTCATCAAAA
AGATGACATTAACAAAAAGGCTTTTGATAAGTTTAAAAAAGAACATGGAGTGGCCTGNNNAGGCTGACAATGCAGCACCG
GTGGGAACGGTTTGAAG
Sequence Type mRNA
Unitrap ID UNI12748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21266184..21269589 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029014 (Dnajc2) NM_009584 DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI (curated);Acc:Dnajc2-006]

 
Come back to gene ENSMUSG00000029014


For any suggestions or comments, please send an email to unitrap@crg.es