Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10343D10
Clone ID IST10343D10
Vector VICTR76
Project tigm

Sequence tag IST10343D10BBF1
Sequence
CCCGCAGTCTCTTGATTANAATAAAAAGGCCCGGCCTGAAGGAGCCGAGCACGGGGTCAGAAGAGTTGTCGACCTCCCGA
GTCCTTGGCTGCTTTTCTCGGATGCCTTTCTTTGGACATTTGTGAACATTTATTCAGGCACAAAAGTACTCACTGTGGCA
GTGGTGGTCTCTGTANTATATGCCAGGGAGGGGAACCCTTCCCAAATCTGGGGGTACTTAATCCTGAGTCAATAAATATA
TGCATGAAGCCGTTATANTCCTTGGAACAGTTCTCTCGTGTTTATTTTGAGGACTCTGGAAGGGATGAATGTAGGGGGAA
AGACAACCTGAGATCCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87841489..87841831 337
 
EST/CDNA Est Name
  BF456710.1 - AI853801.1


Sequence tag IST10343D10HMF2
Sequence
CCCGCAGTCTGTTGATTAAAATAAAAAGGCCCGGCCTGAAGGAGCCGAGCACGGGGTCAGAAGAGTTGTCCCATCTTGCG
GCAGTGGTCGGCCAAGGGCGGGCAGCCTGTGAAATATGGACAGTGTTGGGTCTTTGCTTCTGTTATGTGCACGGGTGAGT
GAAGTCTCACCCATTGATTCTTCCTGATTTCCCCTTCAGACCAGGTCATGATAATACCTACTCTCANANTCCATTGCAGC
TCATGAAAGGTCTAGAGTTCACCAATGGTCCATGGCTAAGGTGCAGTGTGTANCTGANTTCATTACCTGCATACNNNCCN
NTCTTTGCAATCNTTTTATCTTCTCTTTGATGAAGACTATTAACAGTGGATACCTGAGCATGGTGGANCATGCTTCTAAT
CCTAGCATTTGAGANGTGGGATCAGTTGGATTANGAGCTTCCTTGGTTACNTAGGGAGTTAGGCTAACCTACACTAGATG
AGATCTTGCCTGAAGAGATAGACAGACAGACAAAATGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI33334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120929196..120929646 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079103 (Tgm7) transglutaminase 7 Gene [Source:MGI (curated);Acc:Tgm7-001]

 
Come back to gene ENSMUSG00000079103


For any suggestions or comments, please send an email to unitrap@crg.es