Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14502H5
Clone ID IST14502H5
Vector VICTR74
Project tigm

Sequence tag IST14502H5HMR1
Sequence
ACCTCTGGAANAANAATANTCNATGCTCTTAACCNTTGANCNNTCTCTCCANCCCCTGTTTTGTTTTGTTTTAAGACAGG
GATTCTCTTATAACCCTAGCTTTTTGTTTGTTTGTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCNGGAACTC
ACTTTGTANACCAGGCTGGCCTTGAACTCANAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCATGCNCC
ACCNCTGCCNGGTGCTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14502H5BBF1
Sequence
TCCTGAGTTCAAATCCCAGCAACCACATGATGGCTCACAACCATCTGTAA
Sequence Type genomic DNA
Unitrap ID UNI3822 UNI32205 UNI33335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5780766..5780815 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60953848..60953897 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45751525..45751574 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4582906..4582955 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6209269..6209318 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 53384790..53384839 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12796382..12796431 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 10622687..10622736 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13584661..13584710 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031918 (Mtmr2) NP_076347 myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27911649..27911698 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12422501..12422550 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15073495..15073544 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39434916..39434965 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3173514..3173563 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29775023..29775072 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001569 (Gm1040) NM_001033457 gene model 1040, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685886]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46634881..46634930 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039813 (Tbc1d2) NM_198664 TBC1 domain family, member 2 Gene [Source:MGI (curated);Acc:Tbc1d2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23562839..23562888 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71924663..71924712 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 12262595..12262644 50
NO GENE  


Sequence tag IST14502H5HMF2
Sequence
TCCTGAGTTCAAATCCCAGCAACCACATGATGGCTCACAACCATCTGTAATGAGATCTGATGCCCTCTTCTGGTGTGTCT
GGAGACAGCTACAGTGTACTCATATACATAAAACAAATAAATAAACATTAAAACAAAACAAAACAAAAAATACTGACAAA
AGTATAGTTCCTACTTCACTGGTGTTCACAGTCTGGGAGCAAGAGATAAGAGTGGGGCTGGGGCGTATCCAGCGTTGGAG
TACTCCTCTAGCAAGCAAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127624552..127624810 259
NO GENE  

 
Come back to gene ENSMUSG00000039813


For any suggestions or comments, please send an email to unitrap@crg.es