Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10817H1
Clone ID IST10817H1
Vector VICTR76
Project tigm

Sequence tag IST10817H1BBF1
Sequence
CTTGGAGCTAGGCCAGACCANACATCCTTGTGTGACTGCTGCCTTCTCGGTGACAGCCAGATGCTCCCCTATCCAAGCTT
GAACAGGAAGATATTTGCATGATGAGGACCAAATGGCTTTTGGAAAAATACACAGGACAGATGTCCGAGGTTCTGTGTAG
CGCTCACATCACACGGGAACAGTCCAGAGCACANAGGCTCTTCACACATGTTCTANGTATGCTTATAAACAAATCACTGA
ANAAGAGCTCACTAGGTGGTGTTAACCTGTCGGTGAGTGAAAGTATATGTCCNTGCNNGTGTGTCTGCATGTCTNANNAA
ATGANTCCTGGANAAAAGCACGAAAAGGTAGTANGGAAGGAAGGTCTCTCTGANATCTGT

Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101959713..101960091 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]


Sequence tag IST10817H1HMF1
Sequence
CTTGGAGCTAGGCCAGACCANACATCCTTGTGTGACTGCTGCCTTCTCGGTGACAGCCAGATGCTCCCCTATCCAAGCTT
GAACAGGAAGATATTTGCATGATGAGGACCAAATGGCTTTTGGAAAAATACACAGGACAGATGTCCGAGGTTCTGTGTAG
CGCTCACATCACACGGGAACAGTCCAGAGCACANAGGCTCTTCACACATGTTCTAGGTATGCTTATAAACAAATCACTGA
ANAANAGCTCACTANGTGGTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101959826..101960091 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]


Sequence tag IST10817H1HMR1
Sequence
CAANCACCTGTGCTTANCCNCCCCCCTCCCCGCCCACGGCCTTGTTAATCTATACTCCCTCTGCCCCAGGAGCTCATTCC
ACTAGTGCTACCTCCGTTTACCCATCTGATGGAGGAGGATCACCCTGATATATTGCTGAGAAAGTGTAACATAACCCCAC
ACTTCAGCTGACTTTTATAGCCACAGATATAACAAAAACATGATCCCTGATCCTGAAAGAAAATCCTATGTTAGTCACAT
GGTGTTTCCCTGAGCGAGAGTTAAGGATGGANAAGGACGCTAGGCTAGTGATGGAGCTCANCTANCGTCTGCCTAGCATC
TGCCCATCACACGGCTCATGGCTTGTTTCTCCCAGGAAGTGCTCCNNNATGGCANATGTTTTGTTTCCTTCTTATAAAAC
AAGTGAGGGAAGAANGCCNGTGGCNNGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101960088..101960512 397
 
EST/CDNA Est Name
  BB664369.1 - BB622520.1 - AI591432.1 - BB648353.1 - BB857854.1 - BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY152880.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848.1 - BY781742.1 - BY304961.1

 
Come back to gene BB664369.1 - BB622520.1 - AI591432.1 - BB648353.1 - BB857854.1 - BY007731.1 - BY022021.1 - BY228698.1 - BY232852.1 - BY789605.1 - BY152880.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848.1 - BY781742.1 - BY304961.1


For any suggestions or comments, please send an email to unitrap@crg.es