Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0460
Clone ID CC0460
Vector pGT0lxfT2
Project sanger

Sequence tag CC0460
Sequence
CCAAATGTGATCTCAACGGGAAGCCCCGAGAAGCTGAAGTTCGG
Sequence Type mRNA
Unitrap ID UNI1968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126556155..126556198 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040462 (Os9) NM_177614 amplified in osteosarcoma Gene [Source:MGI Symbol;Acc:MGI:1924301]

 
Come back to gene ENSMUSG00000040462


For any suggestions or comments, please send an email to unitrap@crg.es