Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14861D3
Clone ID IST14861D3
Vector VICTR76
Project tigm

Sequence tag IST14861D3HMR1
Sequence
GGCAGTATGCCGGCAGACATGGTGCTGGAGTGGGCCGAGAGTTCTACATCTTCATCTGAAGGCAGCAGGAGATTGTCTGC
TGCAGGCAGCCAGTAAGAGGGTCNCTGGATCACATTAACCACACATAATCACNTATATGAGATCTCNNAGCCCTGTCTCT
ACAATGTCNCCCTTCCTCTAACAAGGCTATGCCTCCTCCAATAANGCCACNCCNCTTAAN
Sequence Type genomic DNA
Unitrap ID UNI33340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729705..30729923 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]


Sequence tag IST14861D3HMF1
Sequence
CTGCCCTGCTTCCCACCATGATGATAATGGATTACACCTCTGAAACTGTAACTCAGCCCCAGTTAAATGTCTGCCGTGGT
CATGGTGTCTCTTACCAGCAATAAAATCCCAACGAAGAGCAGGGTGTGGTGGCGCACACCTTTAATCTCAGCACTCGGGA
GGCAGAGGCAAGCGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAG
AAACCCTGCCTCANAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729919..30730186 264
NO GENE  


Sequence tag IST14861D3BBF1
Sequence
CTGCCCTGCTTCCCACCATGATGATAATGGATTACACCTCTGAAACTGTAACTCAGCCCCAGTTAAATGTCTGCCGTGGT
CATGGTGTCTCTTACCAGCAATAAAATCCCAACGAAGAGCAGGGTGTGGTGGCGCACACCTTTAATCTCAGCACTCGGGA
GGCAGAGGCAAGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAG
AAACCCTGCCTCANANNAAAAAAANAANNNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729919..30730185 259
NO GENE  

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es