Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12494E6
Clone ID IST12494E6
Vector VICTR76
Project tigm

Sequence tag IST12494E6HMF1
Sequence
CAGAACTTCTTTTGGGGAACTCTAGGTACTTTATTTAAATGCAAACTGTAAAGCTGAGGCTAGTCTCCGGCCTCCTGTTG
GGGAGCTGGCTCAGAGAGTAGCTTTTTCGGAGCCTGAGTCCTCAAGCCGACTTTTAAGCAAAAGAGTAATTTTAGTCCTC
AAGGTGATACTTTAGAAGATTTAGAATCTGTGTTCATCTAACAAATTAATTTATCTGGCNNCNNCTGNNCTCNANCNTCA
N
Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115777949..115778188 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 91355571..91355810 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136941044..136941283 222
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52918937..52919176 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7470318..7470557 222
NO GENE  


Sequence tag IST12494E6BBF1
Sequence
ANAACTTCTTTTGGGGAACTCNNNGTACTTTATTTAAATGCAAACTGTAAAGCTGANGCTANTCTCCGGCCTCCTGTTGG
GGANCTGGCTCANAGAGTANCTTTTTCNGAGCCTGAGTCCTCAAGCCGACTTTTAAGCCNAAGAGTAATTTTAGTCCTCA
AGGTGATACTTTAGAAGATTTANAATCTGTGTTCATCTAACAAATTAATTTATCTGGCAGCCACTGCGCTCTATCTTCAT
CTNGTGAAAAAACACAAACTGANTCCCTACCCCAAATTANAACTGGATCTGGACCCTTCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es