Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14592E12
Clone ID IST14592E12
Vector VICTR74
Project tigm

Sequence tag IST14592E12BBF1
Sequence
GATCGGGTCAAACCCAGCTGAGCACCTTGTCTGGCCACCTAGGCCTATTCTCCCACTGACCATTTTCCAAAGCTGACCCT
GTCCTAGCATCTCTGATATCACCCAAAACCATGGCCAGATCCAGAGGTACAGCCCAAAATACCTACGTAAAGAAAGAGAG
GCAAAAGACCCTGTCACCTACCTCCTCCCAGACAGTGGGGCCCAGGCTCTCTGAAGCCCCAGGAAGCAAAAGGCTAGGCC
CTGGTCGACTGGGTGGCCGCGTTTTCTCAGGAATCTAGGTAAGAGGCAGCTTCTCCAGGAACCCAGCCGCGCTTTACGAA
GCACAAATAACAGGAAGAAAGCCGGCTTANGGTGGGNTGGGTGGGGTGGGAGCTGGCGANGGANGGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026365..71313404 378


Sequence tag IST14592E12HMR1
Sequence
ATCNAACTCCCTTTTTATTTGGGAGGAAGGATCTAGGCTGTTGCCGTGCAAAGAGTCCATATGGGCCCCANCNTTCCCTT
TCATGGACACCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026270..71026367 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es