Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14871C11
Clone ID IST14871C11
Vector VICTR76
Project tigm

Sequence tag IST14871C11HMR1
Sequence
TTATAAAAGGAACAAAAATCAAAATTCGGCAATGTGCCGCTGATGCTGTAACGTCTGCTTAATATTTTTTTCCCCATCAG
TTGCAAGCAGCACAGTGGAAAGTTTGGAATATTGTTACCCTGCTTTCCACCCCATGCGAGTGGAGCCAACCTGGATGANA
AGATAAGCCAGAAGCTTTGCTGCCCAGTGACCCCCTTTGTGGTCACTGTGTTCCCANCCGCTGCTTTTTGTGCNNNGTCT
GGCTGAAGGAATGCAAGTGCCCGTTCNNGTN
Sequence Type genomic DNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114630600..114630866 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]


Sequence tag IST14871C11HMF1
Sequence
ATAAGAACAAAAATTTAATAAGTATAAGTGAAATATACGTGAATGAAACTTGGGGAAAACTAGACATTAATTCTAATATC
ATTAGTTGTACAGTATCCCATCTCTTACTAGTTTGCATTTGAACCTATATAAAACTAAAAGGATGGTANTTGANACAGAA
CCTCTCACTGCAAACAAATAAAATAANTANNCNANGANACACAGGATTGANCCNTGANNANGAANACTTCNTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14871C11BBF1
Sequence
ATAAGAACAAAAATTTAATAAGTATAAGTGAAATATACGTGAATGAAACTTGGGGAAAACTAGACATTAATTCTAATATC
ATTAGTTGTACAGTATCCCATCTCTTACTAGTTTGCATTTGAACCTATATAAAACTAAAAGGATGGTAGTTGAGACAGAA
CCTCTCACTGCAAACAAATAAAATAAATAAACAATGAGACACAGGATTGAGCCATGACGAAGAAAACTTCATTTAAAGGT
GGTTCTCCCCTGCTCTGTAACCAGAAACACAAAAGGAATTAGTACGTCATTTAAAAGANACAGGTATTTTATGAAAAATT
CGATACTCATAAACATTTGTATCTNTGCTTTTGAGAATGTCATGGTAAATGTATACNAAAGCACACTCACTCGACTCCTC
CTGAAGCATNNNNNAACNNCCTTCTTCCAACTCNNCGTCCCTTTTGTGANCCACTGAGTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114630146..114630603 431
NO GENE  

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es