Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P019B07
Clone ID P019B07
Vector FlipROSAbetageo
Project ggtc

Sequence tag P019B07
Sequence
CAGCGGCAGTGGCGGCGGCAGCGGCGGCTGGAGCCTCTGATTGGGTTTCGGGGTCCGGTACTGGAGCCAATCAGCGCGGG
CAGCGAACCGGGGGAGCGAGGCACG
Sequence Type mRNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48548951..48549055 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es