Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14728A4
Clone ID IST14728A4
Vector VICTR76
Project tigm

Sequence tag IST14728A4BBF1
Sequence
CACCCGACTGCTCTTCCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCAGTAATGAGATCT
GT
Sequence Type genomic DNA
Unitrap ID UNI5947 UNI30191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 46292691..46292771 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34899229..34899309 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6693905..6693985 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91645616..91645696 77
 
EST/CDNA Est Name
  CX238156.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59376414..59376494 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059586 (Nsmce2) NM_026746 non-SMC element 2 homolog (MMS21, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67370562..67370642 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379655..82379735 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11662705..11662785 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018654 (Ikzf1) NM_009578 IKAROS family zinc finger 1 Gene [Source:MGI (curated);Acc:Ikzf1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62180978..62181058 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56580639..56580719 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20473160..20473240 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73446302..73446382 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128417097..128417177 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705648..25705728 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 75533405..75533485 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117747535..117747615 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151917731..151917811 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126089166..126089246 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127031967..127032047 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 180301379..180301459 77
NO GENE  


Sequence tag IST14728A4HMR1
Sequence
CTCACCTCTCTCCTTCCTTGTCCAAAGACAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 31250872..31250905 34
NO GENE  


Sequence tag IST14728A4HMF2
Sequence
CACCCGACTGCTCTTCCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCAGTAATGAGATCT
GACTCTCTCTTCTGGAGTGTCGGAAGACAGCTACAGTGTACTTACATATAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 125067575..125067720 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025551 (Fgf14) NM_010201 fibroblast growth factor 14 Gene [Source:MGI (curated);Acc:Fgf14-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705583..25705728 142
NO GENE  

 
Come back to gene ENSMUSG00000025551


For any suggestions or comments, please send an email to unitrap@crg.es