Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14799G6
Clone ID IST14799G6
Vector VICTR76
Project tigm

Sequence tag IST14799G6BBF1
Sequence
NTCNNNNNNNNGANCNNNGNNTACCNNNNNCNNNTGANCCNNCNCTTCANGCNNNCNATATCACANCTATTATTTACNAA
AGACTACTTTCANAATTCCCCCANAACCAGGACATAATTCAGTGGTANGGCTCACATANTTCANTCCANGGAANGAAGGG
AGGGGACACANNAATCTCATGANGATGGGACTACAGCTGATCCCAGCAGGCACCGTGGCCAGGTGGCACTCTAAACCCTT
CCTGCCCAGGCAGANCCTGGCTATCTCANTTCTGTGTACCACCANTTAATGCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14799G6HMR1
Sequence
GGACCTGGGTTTGATTCCCAGCAACCACATAGTGGTTTACAACCACTGGCAACTCCAGTTCCAAGGGATCTGATAGCTTC
TCC
Sequence Type genomic DNA
Unitrap ID UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165685621..165685703 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14799G6HMF1
Sequence
GTCCTCTGTAGGAGCAGCCAGTGCTCTAATCCACTGAGCCATCTCTTCAGGCTCCCAATATCACAGCTATTATTTACGAA
AGACTACTTTCAGAATTCCCCCAGAACCAGGACATAATTCAGTGGTAGGGCTCACATAGTTCAATCCAGGGAAGGAAGGG
AGGGGACACAAGAATCTCATGAGGATGGGACTACAGCTGATCCCAGCAGGCACCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165685700..165685917 218
 
EST/CDNA Est Name
  DV042264.1 - CD769643.1 - CA329096.1 - BU531616.1 - CJ169184.1

 
Come back to gene DV042264.1 - CD769643.1 - CA329096.1 - BU531616.1 - CJ169184.1


For any suggestions or comments, please send an email to unitrap@crg.es