Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P109A06
Clone ID P109A06
Vector FlipROSAbetageo
Project ggtc

Sequence tag P109A06
Sequence
TGAGGGGCCCCGAGCTCGCGGCTCTCCGGATTCCGAAGCCTCGGGTTGCTTCGAGGGAGGAGAATCTGCTGCGGCCGATC
CCGCGACACTACTGACCTCCGCGCGACGTGCCCGCCGCCGCTGTTGGTTGGAG
Sequence Type mRNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92512555..92512687 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es