Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117E02
Clone ID P117E02
Vector ROSAbetageo0
Project ggtc

Sequence tag P117E02
Sequence
AGCTCGTTGCAGCTCTAGGCTCTCGGGAAGAGGTGGCTGTGAGGGGCCCCGAGCTCGCGGCTCTCCGGATTCCGAAGCCT
CGGGTTGCTTCGAGGGAGGAGAATCTGTTGCGGCCGATCCCGCGACACTACTGACCTCCGCGCGACGTGCCCACCGCCGC
TGTTGGTTGGAG
Sequence Type mRNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92512555..92512726 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]


SPLK-Sequence tag 5SP117E02
Sequence
AATTTACAGATACTCATAGAGTGCCCTTGTGTTCGAATGAGCATGGTGTCGTCTCTAGCAGAATTGTCATTACACATTAT
GAATATTAGAAGTTATTTTCTAAACTGCCTTAATTTGTCCTGCTTTTCTGTTGAGTGGACATGAGGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP117E02
Sequence
CATCTTTGACGTTTTACACTGAAGCACAAGTTGGATTGCTTGTGAACAGAAAGAGGGTGGAAAGAGTTGAGAGTTTGGAC
CTGGTTACTACACTGGCAGATGTGTGTTTGATAGCTGATAAAGCAAACCTGTGTGTTTTCCCCAAACTCTTAGCAAAAAA
TTGGGTTTTTTTGTGCCTTGGTTTATTTTAATCATCTCTGGATTATCTATCCAAAAATTGTTACTGTGCTAACATTGGGG
ATATTTCTTGCTGGATTGCATGTTGCTGTCCTGTTATTTTCTCCCTCCCACCCCCAAAGCAGGCTTGTCTT
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92509917..92510229 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es