Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11916F1
Clone ID IST11916F1
Vector VICTR76
Project tigm

Sequence tag IST11916F1HMF2
Sequence
GTCTTGTCTTGTCTTGTCTTGTCTTGTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTTCTTTA
Sequence Type genomic DNA
Unitrap ID UNI14267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62247882..62247947 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST11916F1BBF1
Sequence
GTCTTGTCTTGTCTTGTCTTGTCTTGTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTTCNTTANGTGTGTGTATAGA
GAGAGAGGGAAAGAGAGAGAGAGAGACTTATTTGAGTAATATAGATCANGAGTTACCTTAATATATTACTATATAAATCA
NTNANTTNNGAATTGAAATTTTATATTGAATTATTTTTTAACAATNNCNNTTANNATGGTGANNNNNNGNNGTGGCCGTA
AACTTGAGTTTANCNNCCNNAACCCACATAGTANANGGAGGGAATCNNCTCTCACCGGTTGTCTTCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es