Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M094E04
Clone ID M094E04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag M094E04
Sequence
CGCCCCTCTCCGAGAGCTACGCGGCGGCGCAGCACAGGCCTCGTGCGGTAACGGCATCCGGGCAGCCGCGGTGGCGTCCC
GGTGCGGTCCTCAGGTGACTGGAGCCGAGGGCTCGGCGGAGGGAAG
Sequence Type mRNA
Unitrap ID UNI12754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100446414..100446539 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032475 (Nck1) NM_010878 non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI (curated);Acc:Nck1-001]

 
Come back to gene ENSMUSG00000032475


For any suggestions or comments, please send an email to unitrap@crg.es