Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10019D4
Clone ID IST10019D4
Vector VICTR75
Project tigm

Sequence tag IST10019D4BBF1
Sequence
GCTGCACCCGGAAACCAGAACCCGCCCGGTTGCATTTAAAAATGAGGGCATGACTTCAAGGTTTGGTTGAGCCGATTTTA
GATACAAGGGTGAAAGATGCAGGGGAGTCTGGAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52919265..52919383 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055978 (Fut2) NM_018876 fucosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:109374]

 
Come back to gene ENSMUSG00000055978


For any suggestions or comments, please send an email to unitrap@crg.es