Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Q023C05
Clone ID Q023C05
Vector FlipROSAbetageo
Project ggtc

Sequence tag Q023C05
Sequence
AGGCCGCGGCGAGGAAGATGGCGGACGGGAAGGCGGGAGAGGAGAAGCCAGAGAAGCCGCAGCGAGCCGGAGCCGCCGGA
G
Sequence Type mRNA
Unitrap ID UNI8604 UNI8605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56029716..56029796 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071533 (Pcnp) NM_001024622 PEST proteolytic signal containing nuclear protein Gene [Source:MGI (curated);Acc:Pcnp-008]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48475026..48475106 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044211 (AC154013.4)  

 
Come back to gene ENSMUSG00000044211


For any suggestions or comments, please send an email to unitrap@crg.es