Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10780C7
Clone ID IST10780C7
Vector VICTR76
Project tigm

Sequence tag IST10780C7BBF1
Sequence
CTATCTTCAGACACACCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI814 UNI17397 UNI33349 UNI33350 UNI33351 UNI33352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 65517..65552 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 45924..45959 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4647841..4647876 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9659333..9659368 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12249894..12249929 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073463 (AC163687.5) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D4Y9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48304574..48304609 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57981508..57981543 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022359 (2410187C16Rik) NM_029734 RIKEN cDNA 2410187C16 gene Gene [Source:MGI Symbol;Acc:MGI:1924023]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21833148..21833183 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 92249034..92249069 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78152059..78152094 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041958 (Pigs) NM_201406 phosphatidylinositol glycan anchor biosynthesis, class S Gene [Source:MGI (curated);Acc:Pigs-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7975299..7975334 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62975535..62975570 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126883947..126883982 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025404 (R3hdm2) NM_027900 R3H domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1919000]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26355149..26355184 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 71330859..71330894 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107932408..107932443 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029461 (B930006L02Rik) NM_178764 family with sequence similarity 168, member A Gene [Source:MGI Symbol;Acc:MGI:2442372]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20505527..20505562 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 30616642..30616677 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 50919499..50919534 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 148070956..148070991 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38882461..38882496 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71760197..71760232 36
NO GENE  


Sequence tag IST10780C7HMF1
Sequence
CTATCTTCNGACACACCAGAAGAGGGCATCAGATCTCATTACAGATAACTATA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48304574..48304625 50
NO GENE  

 
Come back to gene ENSMUSG00000029461


For any suggestions or comments, please send an email to unitrap@crg.es