Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14703F2
Clone ID IST14703F2
Vector VICTR76
Project tigm

Sequence tag IST14703F2HMR1
Sequence
NNAAAGTGTACACTACCACGACCCGCTCAGTTTGTTTTGTAAAAGAGACAAATTGTTTTCGGCTGGTTTGAGCAACACAA
GTCTTAAATCTCTGTGATTCTCTTCAACTCCATAGAGTTCCAGGACAGCCAGGTCTCCTTGAGGCAGGATCTCTCAGTCA
AACCCAGAGCTCATTCCATAGAGCTAGTCTTGGTAGCTAACTTGCTCTGGGGATTCTGTCTCCATCTTCCAAGGTAGGAA
TTACAGGAGGTCTTCCATGCCTGCTCAGCATTGCCTTGGGTTCTGGGGATCCAAATTTANAACCNTCTCCTTATTCCCTT
NNTNCCNATCCAGCCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI31727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51287269..51287610 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078750 (AC105966.11)  

 
Come back to gene ENSMUSG00000078750


For any suggestions or comments, please send an email to unitrap@crg.es