Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13102C6
Clone ID IST13102C6
Vector VICTR76
Project tigm

Sequence tag IST13102C6HMF2
Sequence
AAGGAAACAAAAAAGCCCCCCACACACACACACAAAGCAAAAATTTTTAGGTAATATTTTCCCCTAAAACAAAATGGTAA
TGATCTTTAAAAAAGATACTAAAAATATTGGCAGGAAAAGAGGCATTTCACTCACCAAAATAGCGTGCTGTATGCTTGCT
TACATCCACTCTATGGTCTTTTAAGCTAACTTTTATACAAAGAAAACGTATGTTAAATACACTAACATTTGGTTCCAATA
TCGCAAAAAATTGGAGGAATGGATAGCAAATACGGGCTCTCTANGTGGGATGANCACNGGGGTGGAGGGTTCNCANTGTG
TTATTAAACTGTTTGGCTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI13419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62350759..62351121 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]


Sequence tag IST13102C6BBF1
Sequence
GCTTCACCGCTTTTGAGGTCATCATTAGAACTCCTCTTGATTTTCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313182..138313234 53
NO GENE  

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es