Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11032G4
Clone ID IST11032G4
Vector VICTR76
Project tigm

Sequence tag IST11032G4HMF1
Sequence
GGGCAGATATATCACCATACTAATTTATTCCCCAGCTATGAGACCCCTTGCTACTTGTGGCTTCTTCAGGCCATTGTGGG
GCAAAAAAATGGTGTCCCGCGACCTCTGGGGGCTAGGGCCATTGGGCAAGGCAGACCCGATGGAATGCCTGGCAGGCGTT
GGACTGTGAGAAGCCCCAGGATCCCACTCCAGGGGTGGGAAAAGGCGCAGTCTAGGGTCCCCCAAGAACCTGCCAGAGTC
GGCGTCCAACTCTTGGGCACCNCANACCACTGANCACCATGGAAGANCCGGTTCTGGGGTCCCTGGGCAGCACGGAGGCA
GCAGGCTCTCATTCTCAGACATCCNAGATGCTGCTGGAAGAGCTGAGAACAAAGTGGGGACCCTCGGGCAGACTCTGGCC
GANGTGGGGGTGGGGGCAAAGTGAANGCNGANGAGTCCTGCTAGCCCANGCGGCTTGCTCTGCGGGTGGA

Sequence Type genomic DNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8886538..8887006 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]


Sequence tag IST11032G4BBF1
Sequence
GGGCAGATATATCACCATACTAATTTATTCCCCAGCTATGAGACCCCTTGCTACTTGTGGCTTCTTCAGGCCATTGTGGG
GCAAAAAAATGGTGTCCCGCGACCTCTGGGGGCTAGGGCCATTGGGCAAGGCAGACCCGATGGAATGCCTGGCAGGCGTT
GGACTGTGAGAAGCCCCAGGATCT

Sequence Type genomic DNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8886538..8886720 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es