Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10070B11
Clone ID IST10070B11
Vector VICTR75
Project tigm

Sequence tag IST10070B11BBF1
Sequence
AAGAGCTGAGCCATCAGCTGGGCATGGTGGCGCAAGCCTTTAGTCCCAGCACTTGGGAGGCAGAGGCTGGCAGATTTCTG
AGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGATACCCTGTCTCGAGAAAATAA
AAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583608..106583773 162
NO GENE  


Sequence tag IST10070B11HMR1
Sequence
TCTTAAGAGCACCAACTGCTCTTCCTGAGGTCCTGAGTTCAATTCTTAGCAACTACATGGTGGCTCAT
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106583544..106583611 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es