Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12336B9
Clone ID IST12336B9
Vector VICTR76
Project tigm

Sequence tag IST12336B9HMF1
Sequence
GGCATGATATCCCACCTCCAGCTGAGGAACTGCTTACAGCTGATGGCTACCGGAGGGAGGAGAGTCATTTTTGTTAAGCG
TTTTCATCCTGCTGGGTGGTAACCCAAGTAGGGGCACACATCTTTAATCCCAGCACTAGAAAGGCAGAGGCAGGTGGATC
TCTGTGAGTTCAAGGTCAGCCTTGTCTACAGAGGGAGCCCTAGGACAGCCAGGGCTACACANANAAATCCTCAAAAAAAA
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21032990..21033230 237
NO GENE  


Sequence tag IST12336B9BBF2
Sequence
ACACTTGGGCTTCTACCTGAGAAAAATCANGTANCAGAGAAGGCTGGAGTTCTCCAAGCTAATTGCGGCATTTANATAGG
CCCCTGAGTGGTCAGGCAATGAACTTCCCTACTTGGGTATTCTGCCTGGCAAAAGGTCTAATTCCTGGTTCATCCTGAGT
AAGGCATATGTGTTCTCATTCGCCATCTAATAAAGCAGTTTCAACAATCAAGACCTTTTCTTCATTAAGGATCACAAGGG
GTGGGGGTGGGGGTCTTCTCTANAAAGCCTTCTTTCCTANCTCCTCCATAGTCTGGGCACTCACTTGGAGCCNAACTGGG
ATCT
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30446691..30447013 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es