Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11567G11
Clone ID IST11567G11
Vector VICTR76
Project tigm

Sequence tag IST11567G11HMF1
Sequence
CTCCGTAGGACCTGAGCCCAGGCCCTTCCCATTCCAGGANCGCAATAGCCCGAGTGGGGGCACTGTCACAAACTCCAGGC
CTCAAAAAGGGCAATACAGCCAGTAAGTATCTCATGCAGATTCACCGAGCCGCTGAAAGGCCACAAGGGGGATGTCNCCC
CAGTTTCATACTCACAACCATCTGANCACATACTGGATGGTGAAGCCGGATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18877919..18878131 205
NO GENE  


Sequence tag IST11567G11HMR1
Sequence
GGAGGACCACGAAAGAACCNCGTTTAATGTAAGGATTGGGGCTTCAGATGACTAAGATTGGGGCCAGTGGTGCACAGGAG
ACAAGCGACTTTGGATCCGTGATAGTGACTTCAAATAGCAGATTCCTACACCCTGGTGGAGAAAGCAGCCGGTGGCATCC
AGTTTTGTCGAGAACTACTGCAGGAGGTTGTTTGCTCTCTGCCGAGCGAGTGAGGAAGAGCTAGAGCCTTTCCCCCCAGC
TAGTACTTGAGTCTCTGGAAGGACCCGAAGGAANCACGAGGAAGCANCCNANCTCTGCTGAAAGAGGANNGGTCTTTCCT
CCTTTCTACTTTGTATTGCATCTAGAGGGAGCTACAGTTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI30216

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18878128..18878496 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022702 (Hira) NM_010435 histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Hira-001]

 
Come back to gene ENSMUSG00000022702


For any suggestions or comments, please send an email to unitrap@crg.es