Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W262F02
Clone ID W262F02
Vector ROSAbetageo
Project ggtc

Sequence tag W262F02
Sequence
AGAATTTCGAATGTGGCGGCGGTAGCTGCGGAGCGCGGCGGAACGGGAGCTTGCATCTGCTGGTCCGGACCTGAGTGGCC
GAG
Sequence Type mRNA
Unitrap ID UNI12753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53828536..53828618 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]

 
Come back to gene ENSMUSG00000023940


For any suggestions or comments, please send an email to unitrap@crg.es