Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15021E11
Clone ID IST15021E11
Vector VICTR78
Project tigm

Sequence tag IST15021E11HMR1
Sequence
NTGGANACAAAAGACAAGAGTTATCGGGCAGCACGGAGCTCTAGCAGGAGACAGGCTGTAGAAACCGAGTTTCTGTTACT
CACTAGCCTTCTGCCTATGACTGANAGAGTCCTGTGTCCACCCCAGANGGCCTTATAAGGGCTTGCCGAATAAACACTGC
CTGGCAGCGAGTGAGTACTGTACTGGACTCGTAAGTGTGGACTGTGGGACCTTGCTCATGGCATCCCCGCTAGTCCTTGG
TTTCTCCTGGCAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI31931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35467734..35467989 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]


Sequence tag IST15021E11BBF1
Sequence
TAGGAAAGCAGATGGCTAAAAGAAAAAGGCCTGGCAATATTTAGTAAGCTGTGAACAGCCTTGGTTTGACTCCCACAGCC
TTTGAAAGGCTCATTTTGAAAGCCATTTTCCAAATACTTCCAAGACCNCAAATGTGCAAATACTTGCCCTCCTCCCCTTC
CTCTTCCCTTCACTACCANCTGACAGTGGTACCATTTCTTGCCTCANNAANTTCATACNANCANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 64119663..64119888 210
 
EST/CDNA Est Name
  CD546909.1 - D21562.1 - BB565747.1


Sequence tag IST15021E11HMF1
Sequence
TAGGAAAGCAGATGGCTAAAAGAAAAAGGCCTGGCAATATTTAGTAAGCTGTGAACAGCCTTGGTTTGACTCCCACAGCC
TTTGAAAGGCTCATTTTGAAAGCCATTTTCCAAATACTTCCAAGACCACAAATGTGCAAATACTTGCCCTCCTCCCCTTC
CTCTTCCCTTCACTACCAGCTGACAGTGGTACCATTTCTTGCCTCAAGAAGTTCATACAAGCAGGACATGTGTCCNAGCT
GTGAACTGAAAGTTCCCANGAGAAAAAANGANGTANGGGTGGGGCANATACATCTATGTTACCNNCTGCNTANTTGGAAG
ATCACTTANAACGGGGAATTGTGGANAACTGAGANNTTTACNNTCNCCNTGGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CD546909.1 - D21562.1 - BB565747.1


For any suggestions or comments, please send an email to unitrap@crg.es