Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12063A5
Clone ID IST12063A5
Vector VICTR76
Project tigm

Sequence tag IST12063A5HMF2
Sequence
ATGTATATACAGAGCAGGTACTGTATAGGCAATAGCATGTAAGATGTCTTAGCTATTCTTTTCTGCTGGGTAATAGTACC
CTTTCTTCTTTGCATGATGTATTGCGTGATGTGTTTGAATAATATGTTA
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20577560..20577687 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST12063A5BBF1
Sequence
CCTGGAAACTTCTGACATAAGCTTTTTGCAAAGAATATTTTTAAAAATGTAACGATCTGATTAACCAATTAGTGCAGTAT
TAGGAAAGATAATAAACATTATTAGTAAAGAGGTTACAGTGATTTATACCAGGTATAGACAGGGCTCAATGTAGTCTCAT
TAAATAAATGTTCAGTTAAGAAAATAGTTTTGAAAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 114635676..114635877 202
 
EST/CDNA Est Name
  BM226231.2 - BM225834.2 - CA892764.1 - AW610930.1 - AI035541.1

 
Come back to gene BM226231.2 - BM225834.2 - CA892764.1 - AW610930.1 - AI035541.1


For any suggestions or comments, please send an email to unitrap@crg.es