Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11742G8
Clone ID IST11742G8
Vector VICTR76
Project tigm

Sequence tag IST11742G8HMF1
Sequence
CCAGGCTGTCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCTGCCTCCGGAGTGCTGGGATTAGAGACTTACTGATAGG
CACGAAAATGATCCAGACTAAGGGCAGGGAGTGTTACTGCATGCCTCCACGTTGAGCTCTAAGAAGACTTTGCGCAGGCG
CGGAAGGAAATCTCGCGAGACTGTCAGAACACTACCGAGAAGCGTGGTAGGGAGGCCATCCTATCGCGAGAACTCTGTCT
TCAGGGTCCGGATCCTTCCACGGCTAAGTGTCTGGGTCGGTCTAAGGTCCGCTCGGATCACCGGAAGGAGCGCTGCCNGC
CGGTAAGGACGAGAGTGGCCGGCGGGCGCGCTTCCTCTTCTGCCCTGTGCCCTTCTTCGCTCCGGCCTGTGGCCTGTCCT
GCCCTCCCCTCCATTCTTCCCGACCCTCGGGTCCGGGACCNCCATCCCACCTGCCTGNACNCGGGGCCCAATGGCCCTTC
CCTTCCCCAGNTCACNTCTGCTGTGATCGCCTCTCCNNTCCNNNNNTCNCGCCAGGCCNNANCTCCNCTCCCNCCCCTCN
Sequence Type genomic DNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32972875..32973433 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]


Sequence tag IST11742G8BBF1
Sequence
CCAGGCTGTCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCTGCCTCCGGAGTGCTGGGATTAGAGACTTACTGATAGG
CACGAAAATGATCCAGACTAAGGGCAGGGAGTGTTACTGCATGCCTCCACGTTGAGCTCTAAGAAGACTTTGCGCAGGCG
CGGAAGGAAATCTCGCGAGACTGTCAGAACACTACCGAGAAGCGTGGTAGGGAGGCCATCCTATCGCGAGAACTCTGTCT
TCAGGGTCCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32972875..32973128 254

 
Come back to gene Mm.390717


For any suggestions or comments, please send an email to unitrap@crg.es