Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14451G2
Clone ID IST14451G2
Vector VICTR74
Project tigm

Sequence tag IST14451G2HMF1
Sequence
GGTCTATGTCACTTCCCTCACTCACTATGTGATAGACACTTTGTTCTAGCAGACTGGTGTTAAAATCTCCTTTGATTAGA
TAGAGAGAGCTCTGAAGTCACAACTTACTGTAAATCTTATTACAGTACTACAGTAACTGAATTTTGCCCAACTATGGCCT
GTGGAAGACTGAGGACTGACCCTTCCCCAAAAGAGCCTTCAGGAAAAAACCCAACCCTGCCCTGACTGTAGCTCCCTAAT
ACTCAGAGGGTATGAACCACTANATAGGTAGGTACTGCTGCAAGCCACCAGGCTCACAAACCTGTTACTCATAAAACATA
CAGTGAGTTANGACTTCTGANGCNGACCNNNNNNAGANAGAGAGANANCNCCCNCTACANACTCNCNNGCTGACTTACNN
TGACNCTAGACNANNTGTNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14451G2HMR1
Sequence
ANNNTGTGGTGTGGTGTTCTGATGGTTAGAAACAAGTCNCAGGTTTTCCTTCTTACACTCAAGAGTGGTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117549127..117549196 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]


Sequence tag IST14451G2BBF1
Sequence
GGTCTATGTCACTTCCCTCACTCACTATGTGATAGACACTTTGTTCTAGCAGACTGGTGTTAAAATCTCCTTTGATTAGA
TAGAGAGAGCTCTGAAGTCACAACTTACTGTAAATCTTATTACAGTACTACAGTAACTGAATTTTGCCCAACTATGGCCT
GTGGAAGACTGAGGACTGACCCTTCCCCAAAAGAGCCTTCAGGAAAAAACCCAACCCTGCCCTGACTGTAGCTCCCTAAT
ACTCAGAGGGTATGAACCACTAGATAGGTAGGTACTGCTGCAAGCCACCAGGCTCACAAACCTGTTACTCATAAAACATA
CAGTGAGTTAGGACTTCTGAGGCTGACCNGANAGAGAGAGAGAGANNNCNCCCACTACANACTCTCTTGCTGACTTACNG
TGACACTAGACANNGTGTAATAAAATACAGAATATANNCGNGAGTNNNCACAATTNNNANGACTTTCNAAAGANCNNCTG
ANAGTTNNNANNNNNNNNTGTGTGNNNGCGGCTTTCTCATCTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es