Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14227H5
Clone ID IST14227H5
Vector VICTR74
Project tigm

Sequence tag IST14227H5HMR1
Sequence
TTTGCGGCCAAAAACAGACGATCTNNAGAGGGACTTGGGCAGGGTTGTGAGAGTGGGACTGAAACCAAGCAACTGGGGGA
GGGTGGCTCTATAAAAAACTAGGGTAGTGGGGGGCCTTTGGAAGGAGAATGACACCTGGAAGGTC
Sequence Type genomic DNA
Unitrap ID UNI33364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7306368..7306511 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031149 (Praf2) NM_138602 PRA1 domain family 2 Gene [Source:MGI (curated);Acc:Praf2-001]


Sequence tag IST14227H5BBF1
Sequence
CAAGCTTCTCGAGTCTAGTAGGTCTTCCCTCTGGGCCCAATAGGAGCAGCTTCTCTACCAGCTCCCTTCCCAAGCCCTGA
CTTTACTACACCTCCACCTCTGGATTAACCCTTCCAGGGCTCCCCTAATCTGCCACTCATATCGCTGAACCTCTTAGGTA
CTCTCACATCCCCATATCAGTCCTTCCTTAAGTCCAGAGTCCACTTCCTAGCCCACACTCCACCTCAGCCCTCCTCCCTT
TTCTACCCAGGTCCTGTGTCTTTCCTCCANACACCTCCCCCATCCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7306083..7306370 286
NO GENE  


Sequence tag IST14227H5HMF1
Sequence
CAAGCTTCTCGAGTCTAGTAGGTCTTCCCTCTGGGCCCAATAGGAGCAGCTTCTCTACCAGCTCCCTTCCCAAGCCCTGA
CTTTACTACACCTCCACCTCTGGATTAACCCTTCCAGGGCTCCCCTAATCTGCCACTCATATCGCTGAACCTCTTAGGTA
CTCTCACATCCCCATATCAGTCCTTCCTTAAGTCCAGAGTCCACTTCCTAGCCCACACTCCACCTCAGCCCTCCTCCCTT
TTCTACCNNGGTCCTGTGTCTTTCCTCCAGACACCTCCCCCATCCCACCTCCATGGCCCTCCTTATAACAAAGATCTGCT
TCCTTCAAATTTTTCCACCCATGCCCCCCANANCTTCATATTCTCCCGAACTCACNCTNNTCAGTCTAGCATTTCCCTTA
NATCCCCCCTCCTTCNCNNNGACCCGNNNGCCCANNCNGNNTNCCGNTAGTANCNTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031149


For any suggestions or comments, please send an email to unitrap@crg.es