Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G076G05
Clone ID G076G05
Vector U3CEO
Project ggtc

Sequence tag G076G05
Sequence
AAATGGGGGACGGGCGGTTTGGCCGCTGGCGGCGTGCGAGCCGGGATGGACCACAAGAGGAAGCCAAGAAGGTAGCCCTC
CGCTACAGCATGAACTCATAATACCTCAGTGGCGGACTTCAGAAAGCCCTGGGAGAGGAAAGCATCCACTCAGAGCAGAG
CTCAGGGTCANNGCTGAAGGGCGAGAGCTGATNNNAGANN
Sequence Type mRNA
Unitrap ID UNI10538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45869675..45878563 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es