Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13000G12
Clone ID IST13000G12
Vector VICTR76
Project tigm

Sequence tag IST13000G12HMR1
Sequence
NTCTGCCTCCTGAGTGCTGGGATNAAAGACGTGCGCTACCACTGCCTGGCTACCTGATGTTTTATAAACATTTTATCAAT
AGCAGCCAAACACTAAGAGACGGAGAAACTGCCCAAGGCTCCACAGTGAGGAAGTGACCATGCCTTGCTGCTGACTCTTG
TCTTCTGACTTTTGT
Sequence Type genomic DNA
Unitrap ID UNI28258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166883378..166883551 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]

 
Come back to gene ENSMUSG00000039501


For any suggestions or comments, please send an email to unitrap@crg.es