Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14490C2
Clone ID IST14490C2
Vector VICTR74
Project tigm

Sequence tag IST14490C2BBF1
Sequence
AGTGAGAGGTAGGAACTGAAAAGAAAAAGCTGTAACATACGACACTGTTTCCCATCTTGGGTCCCTGCAATAACATTCAG
ATGAAAGCTAAGCCATAATTCCTGTCTAGACTTCCAGTTCTCCAAAGAACACAGCCATGTAGCCTTGTTGGAAAAGGTTT
GGGAGATGGGCGGTGGTGGCGCACACCTTTGATCCCAGTACTTGGGAGGCAGAGGCAGAGGCAGGCGGATTTCTGAGTTC
GAGGCGAGTCTATCGAGTGAGTTCCAGGACAAGCCAGGGCTACACAGAGAANCCCTGTCTTGAAAAACCNNNNAAGANAA
AGAAAAGGTATGGGAACAGAAAAATATTTGGGTCAGTNTTTTGGTTATCNTACTGNNNNNCTTCTACNNNTTGGCNNCAN
TNNNGCTANANTCANANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14490C2HMF1
Sequence
AGTGAGAGGTAGGAACTGAAAAGAAAAAGCTGTAACATACGACACTGTTTCCCATCTTGGGTCCCTGCAATAACATTCAG
ATGAAAGCTAAGCCATAATTCCTGTCTAGACTTCCAGTTCTCCAAAGAACACAGCCATGTAGCCTTGTTGGAAAAGGTTT
GGGAGATGGGCGGTGGTGGCGCACACCTTTGATCCCAGTACTTGGGAGGCAGAGGCAGAGGCAGGCGGATTTCTGAGTTC
GAGGCGAGTCTATCGAGTGAGTTCCAGGACAAGCCAGGGCTACNCAGANAAACCCTGTCTTGAAAAACCNNNNNNGANAA
AGAAAAGGTATGGGANCANAN
Sequence Type genomic DNA
Unitrap ID UNI20228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127533032..127533369 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]


Sequence tag IST14490C2HMR1
Sequence
CACTNACTAGGTGAAGAACTCNNNNCCCNCNNAAGCTCCCCGACCTGTTCAAAGTCACACAGTAAATAAAATATGACTAG
AAGGGAACTGCATTCCCCTTCCTTCCAATTCAAGACTTCTGGCTTCATAATTCCCATTCAAATCAATGAAATGTAGTTTT
AGAATGTANACAATTGCCTAAACTACGCAAAGCTAAGTCTGAAGACTTANAAAGAGCGACNCACANAAACNAGATTCTGG
CTGGTTTTGAGGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es