Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10603G7
Clone ID IST10603G7
Vector VICTR76
Project tigm

Sequence tag IST10603G7HMF1
Sequence
AGAAGAAAGCTGCCGATAATATCGCGCCATCACCGCTAGCCCCACTAGTGCGCATGCACTCGATCCTCAGGTCCAGCCTA
TCCTCCCGAGAAGCTCTACGCATGCGCCAGCTCAAGGGTCTTCGTAAGGAGAGACCCGGGCGCCATCCACTCNGAGTGCG
CTTGCGTGAGTACAAGAGCCTGAGAGGGCGGGACTTGCAGGAGGCCGGCTCATTTGCATTTCTGGCGGGAAAAGGCGCGT
GTGAACACGCCTCTTCCGTGACATTCNCAACCGCCGTTCGTCGCTGGTGTCCCTCAACTGAGTCCCGACTCCAGGTACGC
CCTGCCTGTGGCGACTTTNNTGGCAGGTTCCCCGGTAACATCNCCTGCCAGCTCCTTNAAAAACGCCCCAAGTTTTGAGA
CNAGGTTTCTCTGTGTAGCCCTGGCTGACCTGGAACTCACTCTGTANNCCNNGCTGGCCTCNAACTCCNAAATCCTCCTG
CCTCTGCCTCCCGAGCGCTGGGATTAAAGGCGTGCGCCANCGTGACCGGCTTCCTCNNNAAANTTCTAGTGN
Sequence Type genomic DNA
Unitrap ID UNI33367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52459576..52460126 515
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038292 (Ccdc155) NM_201374 coiled-coil domain containing 155 Gene [Source:MGI Symbol;Acc:MGI:2687329]

 
Come back to gene ENSMUSG00000038292


For any suggestions or comments, please send an email to unitrap@crg.es