Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13599A7
Clone ID IST13599A7
Vector VICTR74
Project tigm

Sequence tag IST13599A7HMR1
Sequence
CAATTATCACTTAGAAATTTACCATGCATTTCAAAGAGACTTCATAAAAAACTTTTAAATCATGAAGCATTAATATATGG
TCATTCTTTGACCTGAATTCTCAGTCAGTTCTCATTCCAAAGGGCTGAACTAGGTTTTCTAAAAGCAGTAAGCAAGTTTG
TAGTTAGACAGTCCTTAGTCCAATTTCCTGAGGCCACTTGCTATGGTGGTCCTGATGGAATTTAGTTTCTTCTTGGAAAG
CCCAAGAGAATCTCCAAGTGTTGTAACTGGGTGGAACTGTGTCTGTCTTGCCACCCTTTATTGCTTTCTTGTTCAATAAA
GAGTTTTAGAAGACCAAAAGGACAAATCTATCAGTTAGAAAGCAGCAGTGACAGAGTGGAGAGCTGACCTTCTCATCCTT
TTTTTTTNCNNGNTTTTCNAAAACNGGGTTTCNNTCNGNNNCCNNGN
Sequence Type genomic DNA
Unitrap ID UNI23118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110015818..110016249 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST13599A7BBF1
Sequence
NNNNNNNGNCNNATCNGGNCNNNNANNTTNNANGTNNNNNNNNNNNNNNNNTNCNNNCNNNANNTCTTCATGTCTTTCTT
TTTGTTTTTGGGGTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110016309..110016341 33
NO GENE  

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es