Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M020A04
Clone ID M020A04
Vector U3betageo
Project ggtc

Sequence tag M020A04
Sequence
TGTAGCAACGGACTAGAGTTCCCAGACGCTGGGAGGCTCGCTTCGGTTTTGTTTTGTTTTGAGCCTTCCTTTCCGCAATT
TGACTACATCTCCCAAAAATCCGGTGGGTGGGGACTGCGGACGTAGAGAACGCACGTGGAAAGAAAGTTGCGGGGAGGTG
AGGC
Sequence Type mRNA
Unitrap ID UNI12763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87723471..87723634 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019710 (Mrpl24) NM_026591 mitochondrial ribosomal protein L24 Gene [Source:MGI (curated);Acc:Mrpl24-002]

 
Come back to gene ENSMUSG00000019710


For any suggestions or comments, please send an email to unitrap@crg.es