Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10260D7
Clone ID IST10260D7
Vector VICTR76
Project tigm

Sequence tag IST10260D7HMF2
Sequence
NTATGTGGGTATGTGCATGTGAATACAGTAGCTAGCAGAGGCCGGAAGAGGGCATCAGGTCTGCTGGAGCTGGAGGTATA
GGTGGTTTTGTGCTCCCTGATATGGCTGCTGGAAACTAAACCCTAAAGGGAAGTGAGTACTCTCACTGCTGAGCCATCTT
TCTAGCTCCAACAACTGAATTCTCATTTTTGTCATTTATTCACTTATTTGTTTTTTGTTTGAGTCTGGATCTTACCTGTA
CCCTACACTGACCTTGGGCTTGCTATTTAAACACAGGTTGGTCCAAACTTGTCGCAGTCTGTCTGCATCAGTCTTTCTGA
GTGTTGCGATTACAGCATGAGTTGCTATGTCCAGGACAGCCAGANCAACAAGGGAGTTTTGTTGTCTCAAAAACAACAAA
AATAAAACAAAACAATTNANATATATACATATTCTGGTTATCTATTCAAAATTNATCACAATTTTAAATAAAGAAATATG
TATGTGTGTGTATATGTATATATTATANAANTGNATATATNCNCNCNCNTNCNCATATATATCTATNTATGTATATATAT
ANGTATATNTNCNNATNCNNNCNNNTN
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71190164..71190730 535
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST10260D7BBF1
Sequence
TAATGAGAAGTGGAATTCACCCNTCCTGTCTCCANACCTGGCTAGGTATCANAACCAAGCCCTTCTGGGGTTTTTANAGA
TAACCCCAGGGCANAGAGGGCCAATTCTCTCTTTCAGGGGCCCTGCAGCACCCAGGTAGAGGTTTTTTTTTTTTTTTTTT
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150193123..150193284 148
NO GENE  

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es