Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14447B7
Clone ID IST14447B7
Vector VICTR74
Project tigm

Sequence tag IST14447B7BBF1
Sequence
TTTGGGGGCTCGTCCGGGATCNGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14447B7HMF2
Sequence
GAACTTAGGACCTTCGGAAGAGCAGTCAGTGCTCTTAACTGCTGAGCCATCTCTCCATCTACTCTCATATCGCCATCTTC
CCATACCTCTCTGTAATACCACCCCTTCCTGCTGTTCCTCAATCCTTCTTAGTCTCTGCGGGTATGTGACCGGGTATGTT
TGAAACAGTTCATTTCTTGTGCTTATCTGTTTTCTGTGTATAAGTAAAGGCAAATTANAAGTAACAGAGTAAAAGTGTTT
TGTTTTGTGTTTCTCTTCTCTGTATTCTGGGTCTCTCTTANTATTTTCAATATTCAGTGAGTATATCTGACNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107752838..107753148 307
NO GENE  


Sequence tag IST14447B7HMR1
Sequence
NTTNNAATCCCAGCAACCACATGGTGGCTCATGTGGTAATGAGATCTGATGTCCTCTTCTGATGTGTCTAAAGACAGCTA
AAGCGTACTTACATATAACAATAAATAAATTTAAAGAGAGAGAGAAGCGCATGTGGAGCACAGATGCTCTCCCATTGCAG
GAAAGGCAAGCTGAATGACATGTCCAAATCTTAGCAGCTTTGTCTACTGTGCATTANACCCTATGTTACAGAAGGCTAAA
AAAGTGTCAGGACCCANGGTTTANTTCAGTAAGTTGATTGTCCAGCANACNTGGATCTGAGTTTTCCCCANAACTCACAT
TAN
Sequence Type genomic DNA
Unitrap ID UNI12013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107753151..107753467 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es