Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14822E10
Clone ID IST14822E10
Vector VICTR76
Project tigm

Sequence tag IST14822E10HMF1
Sequence
GTTTTTGTGATGAAACATCGTGACTAAAAGTCAG
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27940480..27940512 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]


Sequence tag IST14822E10BBF1
Sequence
CTACATAGACCCTGTCTCGAAACAATATTGCCTTTAATCCCAACTCTAAGATCAGGTGTTGAAAGTCATCCTCAACTACA
TAGTGAGTTTGAGACCAAAACTGCAGGGCCCCATACACAGAATAGGAGCCTGGCATGGTTACATATGTCTACAATACCCA
AGTGTAAACAGGTGAAGTTAGAAGACTGCAAATTTGTGGCTAGCCTGGACTACAAATAGAAACCACGTCTCAAAATGGAA
CAAAATCAAGAACTCCACCTCTGAAACCTTTGGCCCCATTCCCACTATAGCTGAAGGCCAGCATGGATCTCAGTACAGAA
CTGGCTTTTCTGCCNAGANCAGGGACTTCAGANAGAAGTTGGCTGANGCCTGGAAGTTANAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78374114..78374495 372
 
EST/CDNA Est Name
  BF722133.1


Sequence tag IST14822E10HMR1
Sequence
TAGCCTGGGCTGTAATTTGCTATGTACACAAGGCTGGCCTGGAATCCACANAAATGGCCCTTTGTGCCTTCCTAGTGTTG
GGGTTTAAAATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78374493..78374584 90
NO GENE  

 
Come back to gene BF722133.1


For any suggestions or comments, please send an email to unitrap@crg.es