Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15061E4
Clone ID IST15061E4
Vector VICTR80
Project tigm

Sequence tag IST15061E4HMR1
Sequence
NTCNNANCNNANNNNNNNGANNGGGNNCNNNGNNAAGTGGTTAATCTGCAACCATAANAAANTGTGTTGGCTACNGAATT
CTGAATTCTGAGCTTAAAGTAGGTACTTGCTGCTGGGAATCTGTGCTTCTGCCTGGCTGAGGGGTAAGGGAACCAGGTAT
TGTCTTGCAGTTGCTGTTGAAACTGCTTTCCTGGTTCTTAAAATAGCCTTGACCTTGTTTGCAACCCAAGCTCATCACAG
TTCTCTTGTTTGCCAGGACTTTGCATTCACTGCCACTTTCTAGGCTTATTGTTTTGTTGAATTAAAATTNGACCTAAGAA
AAACAAACCTAAAACACCCAACCCAAGCAACAACCCAGCCATTTATTTTGTATCTTCTGNTTGGTATTTTTCNCCCCTTT
GTTTTTCCTTTANTATCATTGATTAAAAANTAATCCTTTTCTTGTAGGTNCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI13623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107923093..107923520 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]


Sequence tag IST15061E4HMF2
Sequence
AAAGCATCCCTGGTACCTTTACATTTCAGAGGCAAATTTGCAAATCACATCAAAAATCAGTTCATAATTTTCTATTTATT
GTATTATTACNACTTCCATTTCTATTACTTCTTTTAAAACGAAATCCATCANGGCTAGAGACATGCTGCTCTAACTATAT
GTTGGTGAAGTGCATGCTTANCATGTGTGAGAGGCCCTGGGATCAATCCCTANCACAACAAAGTCTTTAACTGTATCATG
TAGGCAGTGAAAGCATCATGACTGACGATCACATGCTTTTAAAGGATGATTTTTTTTTTNTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107922754..107923061 298
NO GENE  


Sequence tag IST15061E4BBF1
Sequence
ANTGGNAGANTNNNNTNNNCNTTGATATTTAACATTTTACTCTTAAAAGATTCAAGTTANACAGTTTCTGTTATGTAACA
TGCACGTTTAATTTTTACATAAAAAGAANATATAACTGGAATATTCTCTCTGACAATATCAATAAATTCTTTTTTTTTTT
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 65015991..65016129 135
NO GENE  

 
Come back to gene ENSMUSG00000032594


For any suggestions or comments, please send an email to unitrap@crg.es