Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M061B01
Clone ID M061B01
Vector U3betageo
Project ggtc

Sequence tag M061B01
Sequence
ACAGGCGACAGCGCTGCAGACGCCATTATCCTCTGCTTCTCCGCTGCACGGACGTCGCCGTCGTGCTCGTCTCCCACTCG
ATTGCGGCCTGTAGG
Sequence Type mRNA
Unitrap ID UNI8590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58503749..58503843 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021546 (Hnrnpk) NP_079555 heterogeneous nuclear ribonucleoprotein K Gene [Source:MGI Symbol;Acc:MGI:99894]

 
Come back to gene ENSMUSG00000021546


For any suggestions or comments, please send an email to unitrap@crg.es