Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14125C3
Clone ID IST14125C3
Vector VICTR74
Project tigm

Sequence tag IST14125C3HMR1
Sequence
NTCCNAGANGACAGGAAGGTGGCCCANANCTGGAACTGAGATGCNCGTCTCCAGGCTGGCTGGCTGGTACCCGGGCAGCA
GAGGTCAGCTCCGAACCCCGCATCCAAGCCGCGGGTTTGGGGGAGCGGAGCCCGCCACCCC
Sequence Type genomic DNA
Unitrap ID UNI17203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41631113..41631251 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es