Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11827A2
Clone ID IST11827A2
Vector VICTR76
Project tigm

Sequence tag IST11827A2HMF1
Sequence
CCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGC
Sequence Type genomic DNA
Unitrap ID UNI33372 UNI33378 UNI33379 UNI33380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 19269..19303 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 688958..688992 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3109340..3109374 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4627346..4627380 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3415998..3416032 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3269547..3269581 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3389809..3389843 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055737 (Ghr) NM_001048147 growth hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95708]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3864588..3864622 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3380491..3380525 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020668 (Kif3c) NM_008445 kinesin family member 3C Gene [Source:MGI Symbol;Acc:MGI:107979]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3063550..3063584 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3556204..3556238 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041624 (Gucy1a2) NM_001033322 guanylate cyclase 1, soluble, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:2660877]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8939184..8939218 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033885 (Pxk) NM_178279 PX domain containing serine/threonine kinase Gene [Source:MGI Symbol;Acc:MGI:1289230]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3228858..3228892 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4755007..4755041 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3889046..3889080 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3133977..3134011 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3300570..3300604 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4054001..4054035 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4284443..4284477 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3158514..3158548 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3530272..3530306 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4689363..4689397 35
NO GENE  


Sequence tag IST11827A2BBF1
Sequence
AAATATTTTAAAAAATTTAATGTGCATTGGTGTTCTGCTTCCATGTATGTCTGTGTGANGGTATGANATCCCCTGGAACT
GGAATTATAGACAGTTGTGAACTGCCATGTGGGTATTGGAAACTGANCCTGGGTCCTTTGGAAGAATANCNNGTGCTGTT
TGATTGGGCTGGANAGACNGCTNANTGGTTAAGTGCACTTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033885


For any suggestions or comments, please send an email to unitrap@crg.es