Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11093B1
Clone ID IST11093B1
Vector VICTR76
Project tigm

Sequence tag IST11093B1BBF1
Sequence
CAAGTACATACAATAACATTTGGGGAGGTAAAGAATGTCTTGTGATTGTTTCAGCTTGCATAGGTTATTTAAAGGCAAAA
GTGATTAACATTTTAACTTGATACTTTTTTAGTGGGTGGTGGATACAGCTAAGAGGGTGGAAAGGTTGGGAAATGTGGAA
CTCAGGAGTATAATTTTAAAAGCCATTAGTGCATTTGAATGCTATCTTTCTAGAAGATTGTGTCGTTAAAAGAT
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36055329..36055562 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


Sequence tag IST11093B1HMF1
Sequence
CAAGTACATACAATAACATTTGGGGAGGTAAAGAATGTCTTGTGATTGTTTCAGCTTGCATAGGTTATTTAAAGGCAAAA
GTGATTAACATTTTAACTTGATACTTTTTTAGTGGGTGGTGGATACAGCTAAGAGGGTGGAAAGGTTGGGAAATGTGGAA
CTCAGGAGTATAATTTTAAAAGCCATTAGTGCATTTGAATGCTATCTTTCTANAANANTGTGTCGTTAAAAGATTTTTTT
TTNCCNNCN

Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36055329..36055573 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es