Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12394C11
Clone ID IST12394C11
Vector VICTR76
Project tigm

Sequence tag IST12394C11HMF1
Sequence
CCAAGTGCTGAAATTCAAGGAGAGTGCTGCTGCCGCCACCACACCTGGGCACAGACTTTAATCTTGTACTGAATGAAGAT
GTGAAAGGCAAACTTGGTCTTTTTTGTAACATTTATTTTGACNAGTGGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112337274..112337406 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]


Sequence tag IST12394C11BBF1
Sequence
NGAGGAGCTGCGACCCTGGTCCAAGTCACCCAGTTTTGGGAGCTCCCTGAGACTCTCATGGTGCTCTAGGTCTCTGGGTT
CTAATCTGTCAAATGTATAATGAGCCATTATCTTCTTCAAGTCATTTCACACACATTTGTATAAACAACCAATTTCTTTT
ATTTTTCATTTTTATAAAACTGAGAAAATATATATTCTTTTGAAATACTTCACAAAAATATAACGTCATGTCAACCAGAT
CTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28943070..28943310 241
 
EST/CDNA Est Name
  BM878303.1

 
Come back to gene BM878303.1


For any suggestions or comments, please send an email to unitrap@crg.es