Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_367A5-3
Clone ID CMHD-GT_367A5-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_367A5-3
Sequence
GTGGGGTCTTTCAAAGAGGACACATAAGCAGACCCGAAACACGGCTTGACTTCCATGAGCGACAGGACCAGCCCTACAGC
GACCATGGATGTGCCGCGATCACTGCTTCTTCACGAATAAATTCACCCTCGAACTGTTAAATCAATAAAGCCTACTGCAG
CCC
Sequence Type mRNA
Unitrap ID UNI12775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148032518..148032667 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038801 (Scgb1c1) NM_001099742 secretoglobin, family 1C, member 1 Gene [Source:MGI Symbol;Acc:MGI:2655401]

 
Come back to gene ENSMUSG00000038801


For any suggestions or comments, please send an email to unitrap@crg.es