Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14729A6
Clone ID IST14729A6
Vector VICTR76
Project tigm

Sequence tag IST14729A6HMR1
Sequence
AGAGGCAGAGTATGCTGCGGGCAGTGCAGGCTCTCACCCAGTGATTGACCCGGTCAATCAACAGGTTCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164596330..164596401 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001403 (Ube2c) NM_026785 ubiquitin-conjugating enzyme E2C Gene [Source:MGI (curated);Acc:Ube2c-002]


Sequence tag IST14729A6BBF1
Sequence
TTTGGAAAAGAGGCACCAGCTACTCAAGGCCGGATCAACAGAAGTGGGCAGTNAAACAGTCACATGGTAAACTGCACGTG
CCAGAATAAGGCTGGGCTCTCAGATCTTT
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20612798..20612904 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST14729A6HMF2
Sequence
CTCTGAATAAAGCAGTTAGAGCCAACTCTCAGGCTGATCGCCAGGCTAGGAGGCAACAGGAGGCACCTCCCGTGCTTCCA
AAGTTTCCCTCCAAAATCTGGTTTTCACCAGGAATTTAAGTGTCACTAAAACATGCAGATTGCTATTTAGGGGTAATGTA
GCAAAGGACGACCAGAGGAGAGAATTCGAAGGTGATGGGACCAGCAATTCCAAGAAGGGTGGGGCTGGGCAAGGTTAGAG
CTGGGGCCTGAAAAGGTAAGCATCGATGAGCCCAGATAAGCCCGACAGCTGCGGANCTCGTGACGGTGGGCGTTCAAAGG
GCTTCCATAANTGAGTACATTGCACCCATACTANCANNTGGCCTGAAGTANNAAAGGNAGTTACNGATAACGGGGTGGGG
ATGGGANNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164595927..164596333 385
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es