Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11301B3
Clone ID IST11301B3
Vector VICTR76
Project tigm

Sequence tag IST11301B3BBF1
Sequence
TTACACACCAGAAGAGGGCATCANATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGAA
CCTCTGCAAGAGCAGTCAGTGCTTTTAACCACTGAGCCATCTCTCCTGCCCCTATATCTACTGTCTTAAGCAAATCTGAN
TCCCANGTATAGTGACCCCAGATCCTCCTCAAGGAGGGGGGGGGCTATTGGGAGGTTTAGGTAAANAAATCCTGGCTTTT
ATCTCCTNTNTTCCNGGAACTGTGTCCTGGTGGGGACCCTTCTTCTACCCTCCCCCCNNNNNNGAAAGCCTCCTTTCCTT
CCTNTANCNNNNCCGCTTCCTCTTNTTNTTCCTCTTCCTNTACCTGCCTTTGNCCTTTNNNGNGTTGCTCTGGANCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11301B3HMF1
Sequence
TTACACACCAGAAGAGGGCATCANATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAN
Sequence Type genomic DNA
Unitrap ID UNI33383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20707456..20707531 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 122636327..122636402 74
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57520549..57520624 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062949 (Atp11c) NM_001037863 ATPase, class VI, type 11C Gene [Source:MGI Symbol;Acc:MGI:1859661]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95557454..95557529 74
NO GENE  

 
Come back to gene ENSMUSG00000062949


For any suggestions or comments, please send an email to unitrap@crg.es